Stem-loop sequence mes-MIR169u

AccessionMI0024271 (change log)
DescriptionManihot esculenta miR169u stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169u
(28 sentences)

Stem-loop
   -         a     u     -cu     uccu     uacu        uggua 
5'  uagccaagg ugacu gccug   ccugc    gcuca    aggguugc     u
    ||||||||| ||||| |||||   |||||    |||||    ||||||||      
3'  aucgguucc acuga cggac   ggaug    ugagu    ucccgacg     a
   a         -     -     uuu     ----     ----        ugaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05005: 20259-20360 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169u
mes-MIR169sscaffold05005: 11750-11840 [+]
mes-MIR169uscaffold05005: 20259-20360 [+]
mes-MIR169zscaffold05005: 23017-23111 [-]
mes-MIR169wscaffold05005: 23286-23394 [-]
mes-MIR169adscaffold05005: 24104-24252 [+]
mes-MIR169vscaffold05005: 24359-24464 [+]
Database links

Mature sequence mes-miR169u

Accession MIMAT0029229
Sequence

1 - 

uagccaaggaugacuugccug

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).