Stem-loop sequence mes-MIR169v

AccessionMI0024272 (change log)
DescriptionManihot esculenta miR169v stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169v
(28 sentences)

Stem-loop
               u    u     -au    auucu     g u     g      u 
5' gguagccaagga gacu gcccg   ccau     gagag u ucaug guauau a
   |||||||||||| |||| |||||   ||||     ||||| | ||||| |||||| u
3' cuaucgguuccu cuga cgggc   ggug     uucuc g aguac uauaua u
               -    -     auc    -----     - c     g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05005: 24359-24464 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169v
mes-MIR169uscaffold05005: 20259-20360 [+]
mes-MIR169zscaffold05005: 23017-23111 [-]
mes-MIR169wscaffold05005: 23286-23394 [-]
mes-MIR169adscaffold05005: 24104-24252 [+]
mes-MIR169vscaffold05005: 24359-24464 [+]
Database links

Mature sequence mes-miR169v

Accession MIMAT0029230
Sequence

3 - 

uagccaaggaugacuugcccg

 - 23

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).