Stem-loop sequence mes-MIR169w

AccessionMI0024273 (change log)
DescriptionManihot esculenta miR169w stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169w
(28 sentences)

Stem-loop
   -          u    u      uuu   a     uu     gu gc   caacaa 
5'  uagccaagga gacu gccuga   ccu gcauu  ggguu  g  uug      u
    |||||||||| |||| ||||||   ||| |||||  |||||  |  |||       
3'  aucgguuccu cuga cggacu   gga cguag  cccaa  u  aac      c
   a          -    -      cuu   -     uu     ug -a   auauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05005: 23286-23394 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169w
mes-MIR169vscaffold05005: 24359-24464 [+]
mes-MIR169adscaffold05005: 24104-24252 [+]
mes-MIR169wscaffold05005: 23286-23394 [-]
mes-MIR169zscaffold05005: 23017-23111 [-]
mes-MIR169uscaffold05005: 20259-20360 [+]
Database links

Mature sequence mes-miR169w

Accession MIMAT0029231
Sequence

1 - 

uagccaaggaugacuugccug

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).