Stem-loop sequence mes-MIR169x

AccessionMI0024274 (change log)
DescriptionManihot esculenta miR169x stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169x
(28 sentences)

Stem-loop
                 c      ---    cacu       c      cuu u 
5' guagccaaggauga uugccc   gcua    gagaagg uuugau   g u
   |||||||||||||| ||||||   ||||    ||||||| ||||||   |  
3' uauugguuccuacu aacggg   cggu    uuuuuuc agauug   c u
                 -      uuu    ---u       a      --u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03800: 17695-17789 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169x
mes-MIR169yscaffold03800: 17965-18073 [-]
mes-MIR169xscaffold03800: 17695-17789 [-]
Database links

Mature sequence mes-miR169x

Accession MIMAT0029232
Sequence

2 - 

uagccaaggaugacuugcccg

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).