Stem-loop sequence mes-MIR169y

AccessionMI0024275 (change log)
DescriptionManihot esculenta miR169y stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169y
(28 sentences)

Stem-loop
   -          u    u      uuu   agcauuuuggguuguggcuugcaaca 
5'  uagccaagga gacu gccuga   ccu                          a
    |||||||||| |||| ||||||   |||                           
3'  aucgguuccu cuga cggacu   gga                          u
   a          -    -      cuu   cauacuucccaauguaaacauauuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03800: 17965-18073 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169y
mes-MIR169yscaffold03800: 17965-18073 [-]
mes-MIR169xscaffold03800: 17695-17789 [-]
Database links

Mature sequence mes-miR169y

Accession MIMAT0029233
Sequence

1 - 

uagccaaggaugacuugccug

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).