Stem-loop sequence mes-MIR169aa

AccessionMI0024277 (change log)
DescriptionManihot esculenta miR169aa stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169aa
(28 sentences)

Stem-loop
      u   -         u    u      aacuucauuggaagagaauuuuuauauau 
5' guu ggu agccaagga gacu gccugc                             a
   ||| ||| ||||||||| |||| ||||||                             g
3' cag cua ucgguuccu cugg uggaug                             a
      u   a         -    -      auguuguuuauuuuguucugaaaagacgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00363: 71664-71779 [-]
intergenic
Database links

Mature sequence mes-miR169aa

Accession MIMAT0029235
Sequence

7 - 

uagccaaggaugacuugccug

 - 27

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).