Stem-loop sequence mes-MIR169ab

AccessionMI0024278 (change log)
DescriptionManihot esculenta miR169ab stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169ab
(28 sentences)

Stem-loop
   guau   -        au    u     u    ug     gauauauaaaaaaaaaugcacaag 
5'     gau agccaagg  gacu gccua cucc  ccgua                        a
       ||| ||||||||  |||| ||||| ||||  |||||                         
3'     cug ucgguuuc  cuga cggau gagg  gguau                        a
   cacu   a        cu    -     c    ug     gcuuucuuggagggugguauaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold09876: 536550-536677 [+]
intergenic
Database links

Mature sequence mes-miR169ab

Accession MIMAT0029236
Sequence

7 - 

uagccaaggaugacuugccua

 - 27

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).