Stem-loop sequence mes-MIR171b

AccessionMI0024280 (change log)
DescriptionManihot esculenta miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171b
(17 sentences)

Stem-loop
         a        ug          u        u      u 
5' aauacg gauauugg  cgguucaauc gauagcag gcucua g
   |||||| ||||||||  |||||||||| |||||||| ||||||  
3' uuaugc cuauaacc  gccgaguuag uuguuguu cgagau c
         a        gu          u        u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06598: 144796-144885 [-]
intergenic
Database links

Mature sequence mes-miR171b

Accession MIMAT0029238
Sequence

66 - 

uugagccgugccaauaucacg

 - 86

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).