Stem-loop sequence mes-MIR171c

AccessionMI0024281 (change log)
DescriptionManihot esculenta miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171c
(17 sentences)

Stem-loop
      a        ug             g     u      u 
5' acg gauauugg  cgguucaaucaga agcag gcucua g
   ||| ||||||||  ||||||||||||| ||||| ||||||  
3' ugc cuauaacc  gccgaguuaguuu uuguu cgagau a
      a        gu             g     u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02717: 36349-36432 [-]
intergenic
Database links

Mature sequence mes-miR171c

Accession MIMAT0029239
Sequence

63 - 

uugagccgugccaauaucacg

 - 83

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).