Stem-loop sequence mes-MIR171d

AccessionMI0024282 (change log)
DescriptionManihot esculenta miR171d stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

8 open access papers mention mes-MIR171d
(26 sentences)

Stem-loop
   -           u         g   ucuucuucauuuuaucaagaaaugg 
5'  gugauauuggu cggcucguc ucu                         a
    ||||||||||| ||||||||| |||                          
3'  cacuauaaccg gccgaguag aga                         u
   g           u         a   ugaccuagaagguauugaucggucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07330: 183574-183676 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR171d
mes-MIR171dscaffold07330: 183574-183676 [-]
mes-MIR171lscaffold07330: 183561-183688 [+]
Database links

Mature sequence mes-miR171d

Accession MIMAT0029240
Sequence

83 - 

augagccgugccaauaucacg

 - 103

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).