Stem-loop sequence mes-MIR171f

AccessionMI0024284 (change log)
DescriptionManihot esculenta miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171f
(16 sentences)

Stem-loop
         c          a         c  a  -  -ga      uauu 
5' agaaag gauguuggug gguucaauc ga ga cg   uuuaca    c
   |||||| |||||||||| ||||||||| || || ||   ||||||     
3' ucuuuc cuauaaccgc ccgaguuag cu cu gc   aaaugu    a
         a          g         a  -  a  aga      uaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05760: 38935-39031 [+]
intergenic
Database links

Mature sequence mes-miR171f

Accession MIMAT0029242
Sequence

70 - 

agauugagccgcgccaauauc

 - 90

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).