Stem-loop sequence mes-MIR171g

AccessionMI0024285 (change log)
DescriptionManihot esculenta miR171g stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171g
(16 sentences)

Stem-loop
        u        g            a  c   ucu    a 
5' agagg gauguugg auggcucaauca au aaa   ccca g
   ||||| |||||||| |||||||||||| || |||   |||| g
3' ucucc cuauaacc ugccgaguuagu ua uuu   gggu u
        -        g            c  a   ccu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold09876: 304317-304402 [+]
intergenic
Database links

Mature sequence mes-miR171g

Accession MIMAT0029243
Sequence

61 - 

ugauugagccgugccaauauc

 - 81

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).