Stem-loop sequence mes-MIR171i

AccessionMI0024287 (change log)
DescriptionManihot esculenta miR171i stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171i
(16 sentences)

Stem-loop
   u    u  c     u         c       c     -  u   a   -        aau   uu  uu 
5'  gaaa ag gauug gauauuggc ugguuca ucaga ca gga aac cuacccuu   uuc  gc  c
    |||| || ||||| ||||||||| ||||||| ||||| || ||| ||| ||||||||   |||  ||  u
3'  cuuu uc uugac cuauaaccg gccgagu aguuu gu ucu uug ggugggaa   gag  cg  u
   a    c  -     u         u       u     u  -   g   u        -gu   uu  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07520: 2504286-2504423 [+]
intergenic
Database links

Mature sequence mes-miR171i

Accession MIMAT0029245
Sequence

104 - 

ugauugagccgugccaauauc

 - 124

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).