Stem-loop sequence mes-MIR171j

AccessionMI0024288 (change log)
DescriptionManihot esculenta miR171j stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171j
(16 sentences)

Stem-loop
         u   g    u         c       c    acguggaaaaccuacccuuuucucggc 
5' gugaaa agc auug gauauuggc ugguuca ucag                           u
   |||||| ||| |||| ||||||||| ||||||| ||||                           u
3' uacuuu ucg ugac cuauaaccg gccgagu aguc                           u
         c   -    u         u       u    ucguucuguuguagcagguucguuuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06512: 1322382-1322513 [+]
intergenic
Database links

Mature sequence mes-miR171j

Accession MIMAT0029246
Sequence

97 - 

ugauugagccgugccaauauc

 - 117

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).