Stem-loop sequence mes-MIR171k

AccessionMI0024289 (change log)
DescriptionManihot esculenta miR171k stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171k
(16 sentences)

Stem-loop
        a        a            a  c   ucu      g 
5' aagag gauguugg auggcucaauca au aaa   cucaag g
   ||||| |||||||| |||||||||||| || |||   ||||||  
3' uucuc cuauaacc ugccgaguuagu ua uuu   ggguuc u
        c        g            c  a   ccu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01701: 155454-155543 [+]
intergenic
Database links

Mature sequence mes-miR171k

Accession MIMAT0029247
Sequence

64 - 

ugauugagccgugccaauauc

 - 84

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).