Stem-loop sequence mes-MIR172b

AccessionMI0024290 (change log)
DescriptionManihot esculenta miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention mes-MIR172b
(8 sentences)

Stem-loop
                  c        a    ug   augcagagaaugagcuagcuagcu 
5' gcuggugcagcauca caagauuc cauu  caa                        u
   ||||||||||||||| |||||||| ||||  |||                        c
3' cggcuacgucguagu guucuaag guga  guu                        a
                  a        a    ga   auguacuuccucagcccgucuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05815: 307843-307961 [+]
intergenic
Database links

Mature sequence mes-miR172b

Accession MIMAT0029248
Sequence

95 - 

agaaucuugaugaugcugcau

 - 115

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).