Stem-loop sequence mes-MIR172c

AccessionMI0024291 (change log)
DescriptionManihot esculenta miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention mes-MIR172c
(8 sentences)

Stem-loop
          ua    c a  c             uucucacuucaaauaacuuugguucauggggaugaagag 
5' agucguu  uugc g ug agcaucaucaaga                                       a
   |||||||  |||| | || |||||||||||||                                        
3' ucagcaa  aacg c gc ucguaguaguucu                                       g
          ca    c c  a             aaguguacguuuacgugccaccacuaggagagagagaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04182: 269279-269422 [+]
intergenic
Database links

Mature sequence mes-miR172c

Accession MIMAT0029249
Sequence

109 - 

ugaaucuugaugaugcuacgc

 - 129

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).