Stem-loop sequence mes-MIR172d

AccessionMI0024292 (change log)
DescriptionManihot esculenta miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention mes-MIR172d
(8 sentences)

Stem-loop
                           acaugcaaaugcauuucuuugucuuucucucucucuuucu 
5' gcuggugcagcaucaucaagauuc                                        c
   ||||||||||||||||||||||||                                        u
3' cggcuacgucguaguaguucuaag                                        c
                           agugagaguaggaaguuuugguucuuuuuuaucuaucugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00224: 433803-433933 [+]
intergenic
Database links

Mature sequence mes-miR172d

Accession MIMAT0029250
Sequence

107 - 

agaaucuugaugaugcugcau

 - 127

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).