Stem-loop sequence mes-MIR172e

AccessionMI0024293 (change log)
DescriptionManihot esculenta miR172e stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention mes-MIR172e
(8 sentences)

Stem-loop
          gu      a  g                a  aacuu    -u      -cg    gg     aacuu  u   ag  g u 
5' agucacu  uugccg ug agcaucaucaagauuc ca     uauc  ggggcu   uggg  uggag     gg gau  ug c u
   |||||||  |||||| || |||||||||||||||| ||     ||||  ||||||   ||||  |||||     || |||  || |  
3' ucgguga  aacggc ac ucguaguaguucuaag gu     auag  ucccga   accu  acuuc     cc cug  gu g u
          au      g  g                g  -----    uu      uaa    -a     guuuu  -   gu  g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06705: 57288-57454 [+]
intergenic
Database links

Mature sequence mes-miR172e

Accession MIMAT0029251
Sequence

132 - 

ggaaucuugaugaugcugcag

 - 152

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).