Stem-loop sequence mes-MIR319a

AccessionMI0024295 (change log)
DescriptionManihot esculenta miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR319a
(25 sentences)

Stem-loop
   cu            cg         u  a    -u  u g   c   ----a   g    cu        aa   a           augag 
5'   ggagcuccuuuu  aguccaaua gg gggc  ga c cgg aag     gcu ccau  caugcacu  ggc agacuucacau     a
     ||||||||||||  ||||||||| || ||||  || | ||| |||     ||| ||||  ||||||||  ||| |||||||||||     a
3'   ccucgagggaag  ucagguuau cc cccg  cu g gcc uuc     cga ggug  guacguga  ccg uuugaagugua     a
   uc            --         -  a    cu  c g   -   cucaa   g    ug        -a   g           aaagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10493: 48255-48431 [-]
intergenic
Database links

Mature sequence mes-miR319a

Accession MIMAT0029253
Sequence

157 - 

uuggacugaagggagcucccu

 - 177

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).