Stem-loop sequence mes-MIR319b

AccessionMI0024296 (change log)
DescriptionManihot esculenta miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR319b
(22 sentences)

Stem-loop
     a     uu          cuc     u   aa            a -  g   ac       uc  aa    gaguuaaa   c     g 
5' ag gagcu  cuucagucca   auggg ggc  uaagauuuaauu g cu ccg  ucauuca  ca  uacu        ggg uagcu a
   || |||||  ||||||||||   ||||| |||  |||||||||||| | || |||  |||||||  ||  ||||        ||| ||||| g
3' uc cucga  gaagucaggu   ugucc ucg  auucuaaguuaa c ga ggc  aguaagu  gu  auga        ccc auugg g
     c     gg          uca     u   -a            a a  g   ga       ga  aa    --------   -     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10122: 61588-61763 [+]
intergenic
Database links

Mature sequence mes-miR319b

Accession MIMAT0029254
Sequence

156 - 

uuggacugaagggagcucccu

 - 176

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).