Stem-loop sequence mes-MIR319c

AccessionMI0024297 (change log)
DescriptionManihot esculenta miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR319c
(20 sentences)

Stem-loop
   gcaauauguuaacguuaaucaggacauaguaau           u   a                 cu      cg  u       uu  a    a g   ac        u  aa        g  ---a  g 
5'                                  gagaaaugguu aag gagcuuccuucagucca  caugga  gg gaagggu  ga uuau u ccg  ucauucau ca  cacaauag aa    ug u
                                    ||||||||||| ||| |||||||||||||||||  ||||||  || |||||||  || |||| | |||  |||||||| ||  |||||||| ||    ||  
3'                                  uucuuugucaa uuc cucgagggaagucaggu  gugucu  uc cuuccua  uu aaua a ggc  aguaagug gu  guguuauc uu    ac a
   ---------------------------------           u   c                 uc      cu  u       cu  a    g g   gu        u  aa        g  agug  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06557: 7971-8204 [+]
intergenic
Database links

Mature sequence mes-miR319c

Accession MIMAT0029255
Sequence

201 - 

uuggacugaagggagcucccu

 - 221

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).