Stem-loop sequence mes-MIR319d

AccessionMI0024298 (change log)
DescriptionManihot esculenta miR319d stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR319d
(20 sentences)

Stem-loop
   uuuugccuugugcaaguuccaugugaug        --         u   a                 cu      cg  u      uu    ---    a g   ac        u  aa        aaaaagg 
5'                             uauuauga  gaaacgguu aag gagcuuccuucagucca  caugga  gg gaaggg  ugaa   uuau u ccg  ucauucau ca  cgcaauag       g
                               ||||||||  ||||||||| ||| |||||||||||||||||  ||||||  || ||||||  ||||   |||| | |||  |||||||| ||  ||||||||       u
3'                             guaguacu  cuuuguuaa uuc cucgagggaagucaggu  gugucu  uc cuuccu  acuu   aaua a ggc  aguaagua gu  guguuauc       a
   ----------------------------        uc         u   c                 uc      cu  u      --    uaa    g g   gu        u  aa        guuggag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03429: 24109-24350 [+]
intergenic
Database links

Mature sequence mes-miR319d

Accession MIMAT0029256
Sequence

201 - 

uuggacugaagggagcucccu

 - 221

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).