Stem-loop sequence mes-MIR319e

AccessionMI0024299 (change log)
DescriptionManihot esculenta miR319e stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR319e
(20 sentences)

Stem-loop
   aa            ugucc           gu   -    -   ---   u     g   ag       u        u    a   gguaa 
5'   ggagcucucuuc     aguccaaggca  uga agcc uga   aac uagcu cug  ucguugg ucaagagc cauc uau     g
     ||||||||||||     |||||||||||  ||| |||| |||   ||| ||||| |||  ||||||| |||||||| |||| |||      
3'   ccucgagggaag     ucagguucugu  gcu ucgg acu   uug aucga gac  agcaacc aguuuuug guag gua     c
   uc            -----           --   g    u   guc   u     g   ga       u        u    a   aguga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03264: 101781-101954 [-]
intergenic
Database links

Mature sequence mes-miR319e

Accession MIMAT0029257
Sequence

154 - 

uuggacugaagggagcucccu

 - 174

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).