Stem-loop sequence mes-MIR319g

AccessionMI0024301 (change log)
DescriptionManihot esculenta miR319g stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR319g
(20 sentences)

Stem-loop
         -  a     ---u ug  a             c   cu      ug  guaaa    --      a     g   ac        u   g   u     acag      u gu 
5' gaaugu gg aaugg    g  ag gagcuuccuucag cca  caugga  gg     aggg  gcggaa uaucu ccg  ucauucau caa cac aguag    agauac g  a
   |||||| || |||||    |  || ||||||||||||| |||  ||||||  ||     ||||  |||||| ||||| |||  |||||||| ||| ||| |||||    |||||| |   
3' uuuaca cc uuauc    c  uc cucgagggaaguc ggu  gugucu  uc     uccc  cguuuu auaga ggc  aguaagug guu gug ucauc    uuugug c  a
         u  a     ucuu cu  -             a   uc      uu  -----    ua      a     g   gu        c   a   -     --ga      u au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03454: 69872-70096 [-]
intergenic
Database links

Mature sequence mes-miR319g

Accession MIMAT0029259
Sequence

184 - 

uuggacugaagggagcuccuu

 - 204

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).