Stem-loop sequence mes-MIR319h

AccessionMI0024302 (change log)
DescriptionManihot esculenta miR319h stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR319h
(20 sentences)

Stem-loop
      a             c   cu      ug   uuaa    --  u   c     g   ac        u   g   u     a a    gu 
5' gag gagcuuccuucag cca  caugga  ggg    aggg  gc gaa uaucu ccg  ucauucau uga cac aguag c aaga  u
   ||| ||||||||||||| |||  ||||||  |||    ||||  || ||| ||||| |||  |||||||| ||| ||| ||||| | ||||  a
3' cuc cucgagggaaguc ggu  gugucu  uuc    uccc  cg uuu auaga ggc  aguaagug guu gug ucauc g uuuu  c
      -             a   uc      uu   ----    ua  u   a     g   gu        u   g   -     - a    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02877: 33218-33397 [-]
intergenic
Database links

Mature sequence mes-miR319h

Accession MIMAT0029260
Sequence

159 - 

cuuggacugaagggagcuccu

 - 179

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).