Stem-loop sequence mes-MIR390

AccessionMI0024303 (change log)
DescriptionManihot esculenta miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

4 open access papers mention mes-MIR390
(38 sentences)

Stem-loop
       u         u  u          g         c     -u    --uaauau      ucuuu 
5' agua ggaagaauc gu aagcucagga ggauagcgc augga  gauu        aagccc     u
   |||| ||||||||| || |||||||||| ||||||||| |||||  ||||        ||||||     u
3' ucgu ucuucuugg ua uuugaguccu ccuaucgcg uaucu  cuag        uuuggg     c
       -         c  c          a         a     cu    uaucuucu      uacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05375: 104124-104260 [-]
intergenic
Database links

Mature sequence mes-miR390

Accession MIMAT0029261
Sequence

102 - 

cgcuauccauccugaguuuc

 - 121

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).