Stem-loop sequence mes-MIR393a

AccessionMI0024304 (change log)
DescriptionManihot esculenta miR393a stem-loop
Gene family MIPF0000083; MIR393
Literature search

4 open access papers mention mes-MIR393a
(20 sentences)

Stem-loop
       u     ac            c    u     uaaaacucuucucuuuc 
5' acua aggag  auccaaagggau gcau gaucc                 a
   |||| |||||  |||||||||||| |||| |||||                  
3' uggu uccuc  uagguuucccua cgua cuagg                 u
       u     cu            u    -     uuuucucucuaauuuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12439: 276547-276651 [-]
intergenic
Database links

Mature sequence mes-miR393a

Accession MIMAT0029262
Sequence

14 - 

uccaaagggaucgcauugauc

 - 34

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).