Stem-loop sequence mes-MIR393d

AccessionMI0024307 (change log)
DescriptionManihot esculenta miR393d stem-loop
Gene family MIPF0000083; MIR393
Literature search

4 open access papers mention mes-MIR393d
(18 sentences)

Stem-loop
   u  uuag    u  ---   c          a            u      c   uuccuccauu  a    uua 
5'  ga    uuag gc   agg ggaggguucc aagggaucgcau gaucua uga          aa ugag   a
    ||    |||| ||   ||| |||||||||| |||||||||||| |||||| |||          || ||||    
3'  cu    aauc cg   ucc ccucuuaagg uucccuagcgua cuaggu acu          uu acuc   a
   a  --ua    u  aua   a          a            -      u   ----uauuuu  c    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00341: 615432-615573 [+]
intergenic
Database links

Mature sequence mes-miR393d

Accession MIMAT0029265
Sequence

26 - 

uccaaagggaucgcauugaucu

 - 47

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).