Stem-loop sequence mes-MIR394b

AccessionMI0024308 (change log)
DescriptionManihot esculenta miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention mes-MIR394b
(15 sentences)

Stem-loop
        u      a        uuu  u            -    u c           -  ucuau     ucu 
5' ucaug ggguuu acaaaggg   cu acagaguuuauu ggca u uguccaccucc ca     ggaaa   u
   ||||| |||||| ||||||||   || |||||||||||| |||| | ||||||||||| ||     |||||    
3' aguac cccaaa uguuucuc   gg ugucucgaguga cugu a acggguggagg gu     cuuuu   c
        u      a        ucu  u            a    c u           u  --uuu     ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02943: 554374-554519 [+]
intergenic
Database links

Mature sequence mes-miR394b

Accession MIMAT0029266
Sequence

38 - 

uuggcauucuguccaccucc

 - 57

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).