Stem-loop sequence mes-MIR394c

AccessionMI0024309 (change log)
DescriptionManihot esculenta miR394c stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention mes-MIR394c
(26 sentences)

Stem-loop
   u          u        u   u         uauaua      ua 
5'  ugcagagcca uuuggcau cug ccaccucca      agaguu  a
    |||||||||| |||||||| ||| |||||||||      ||||||  u
3'  augucucggu aaaccgua gac gguggaggu      ucuuaa  a
   a          c        c   c         ------      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06914: 512410-512502 [-]
intergenic
Database links

Mature sequence mes-miR394c

Accession MIMAT0029267
Sequence

14 - 

uuggcauucuguccaccuccau

 - 35

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).