Stem-loop sequence mes-MIR395a

AccessionMI0024310 (change log)
DescriptionManihot esculenta miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention mes-MIR395a
(10 sentences)

Stem-loop
            ug         -       cccu   ua 
5' gaguucccc  agcacuuca uugggag    uaa  u
   |||||||||  ||||||||| |||||||    |||  a
3' cucaagggg  uugugaagu aaccuuc    guu  c
            gu         c       ---u   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11495: 409809-409881 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR395a
mes-MIR395bscaffold11495: 417324-417391 [+]
mes-MIR395ascaffold11495: 409809-409881 [-]
Database links

Mature sequence mes-miR395a

Accession MIMAT0029268
Sequence

53 - 

cugaaguguuugggggaacuc

 - 73

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).