Stem-loop sequence mes-MIR395b

AccessionMI0024311 (change log)
DescriptionManihot esculenta miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention mes-MIR395b
(11 sentences)

Stem-loop
            ug c       u    gc  uaua 
5' gaguucccu  a cacuuca uggg  ua    c
   |||||||||  | ||||||| ||||  ||     
3' cucaagggg  u gugaagu accc  au    u
            gu u       c    uc  cauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11495: 417324-417391 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR395b
mes-MIR395ascaffold11495: 409809-409881 [-]
mes-MIR395bscaffold11495: 417324-417391 [+]
Database links

Mature sequence mes-miR395b

Accession MIMAT0029269
Sequence

48 - 

cugaaguguuugggggaacuc

 - 68

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).