Stem-loop sequence mes-MIR395c

AccessionMI0024312 (change log)
DescriptionManihot esculenta miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention mes-MIR395c
(10 sentences)

Stem-loop
           u c  ua         ug u       u       ucaauaa 
5' aucaagug c cc  gaguucucc  a cacuuca uguagac       g
   |||||||| | ||  |||||||||  | ||||||| |||||||        
3' uaguuuac g gg  cucaagggg  u gugaagu acguuug       g
           u u  uc         gu u       c       uugauga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07690: 1450-1551 [+]
intergenic
Database links

Mature sequence mes-miR395c

Accession MIMAT0029270
Sequence

67 - 

cugaaguguuugggggaacuc

 - 87

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).