Stem-loop sequence mes-MIR395d

AccessionMI0024313 (change log)
DescriptionManihot esculenta miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention mes-MIR395d
(10 sentences)

Stem-loop
           u uc            ug u       c      ggg  acag 
5' gucaggug c  cuggaguucccc  a cacuuca uggggu   cu    u
   |||||||| |  ||||||||||||  | ||||||| ||||||   ||     
3' caguuuac g  ggccucaagggg  u gugaagu auccca   gg    u
           c gu            gu u       c      -aa  accu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01497: 23497-23599 [+]
intergenic
Database links

Mature sequence mes-miR395d

Accession MIMAT0029271
Sequence

68 - 

cugaaguguuugggggaacuc

 - 88

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).