Stem-loop sequence mes-MIR395e

AccessionMI0024314 (change log)
DescriptionManihot esculenta miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention mes-MIR395e
(10 sentences)

Stem-loop
   -       gu     u          -u   g        cugaa      cg  cg       -   --   a  aa 
5'  guuuggg  caccu gaguuccucc  acu cuucagua     gcuguu  au  ucuuagc aau  ggc ug  a
    |||||||  ||||| ||||||||||  ||| ||||||||     ||||||  ||  ||||||| |||  ||| ||  u
3'  caaaccc  guggg cucaaggagg  ugg gaagucgu     cgguaa  ua  aggguug uua  ucg ac  u
   u       uc     u          uu   -        -uuag      ag  aa       a   au   -  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00080: 382438-382588 [-]
intergenic
Database links

Mature sequence mes-miR395e

Accession MIMAT0029272
Sequence

115 - 

cugaaggguuuggaggaacuc

 - 135

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).