Stem-loop sequence mes-MIR396a

AccessionMI0024315 (change log)
DescriptionManihot esculenta miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

4 open access papers mention mes-MIR396a
(15 sentences)

Stem-loop
   u      c  c    uc            c          u ucu    c     uugugguuauugcaugccacg 
5'  ggcccu uu guau  uuccacagcuuu uugaacugca c   acaa gaagc                     g
    |||||| || ||||  |||||||||||| |||||||||| |   |||| |||||                      
3'  cuggga ag caua  agggugucgaaa aacuuggcgu g   uguu uuuug                     c
   a      c  u    ga            u          u uuu    c     uucuucggcgaauuaaccgcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05760: 81136-81289 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR396a
mes-MIR396ascaffold05760: 81136-81289 [-]
mes-MIR396dscaffold05760: 75842-75935 [+]
Database links

Mature sequence mes-miR396a

Accession MIMAT0029273
Sequence

18 - 

uuccacagcuuucuugaacug

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).