Stem-loop sequence mes-MIR396b

AccessionMI0024316 (change log)
DescriptionManihot esculenta miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention mes-MIR396b
(13 sentences)

Stem-loop
         c  u    uc            c          u --u  uau    uu  uga     g 
5' gauccu uu guau  uuccacagcuuu uugaacugca c   ac   gaac  ga   uuguu c
   |||||| || ||||  |||||||||||| |||||||||| |   ||   ||||  ||   |||||  
3' cuggga ag caua  agggugucgaaa aacuuggcgu g   ug   uuug  cu   ggcgg a
         u  u    ga            u          u uuu  -uu    uu  -ua     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05297: 2437-2566 [+]
intergenic
Database links

Mature sequence mes-miR396b

Accession MIMAT0029274
Sequence

17 - 

uuccacagcuuucuugaacug

 - 37

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).