Stem-loop sequence mes-MIR396c

AccessionMI0024317 (change log)
DescriptionManihot esculenta miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention mes-MIR396c
(15 sentences)

Stem-loop
   u      c                         ucu  uuc   uuc 
5'  gucaug uuuuccacagcuuucuugaacuucu   uc   auc   u
    |||||| |||||||||||||||||||||||||   ||   |||    
3'  cgguac agagggugucgaaagaacuugaaga   gg   uag   g
   a      a                         uuc  uuu   uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12498: 129874-129969 [-]
intergenic
Database links

Mature sequence mes-miR396c

Accession MIMAT0029275
Sequence

11 - 

uuccacagcuuucuugaacuu

 - 31

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).