Stem-loop sequence mes-MIR396d

AccessionMI0024318 (change log)
DescriptionManihot esculenta miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention mes-MIR396d
(13 sentences)

Stem-loop
                    a     -uuuua      uuuca     cu 
5' uuccacagcuuucuuga cuuuc      cugccu     aaucu  c
   ||||||||||||||||| |||||      ||||||     |||||   
3' agggugucgaaagaacu gaagg      gaugga     uuaga  u
                    c     uuucaa      -uaac     uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05760: 75842-75935 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR396d
mes-MIR396dscaffold05760: 75842-75935 [+]
mes-MIR396ascaffold05760: 81136-81289 [-]
Database links

Mature sequence mes-miR396d

Accession MIMAT0029276
Sequence

1 - 

uuccacagcuuucuugaacuu

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).