Stem-loop sequence mes-MIR396e

AccessionMI0024319 (change log)
DescriptionManihot esculenta miR396e stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention mes-MIR396e
(13 sentences)

Stem-loop
         c                   a      uuua 
5' gucaug uuuuccacagcuuucuuga cuuucu    c
   |||||| ||||||||||||||||||| ||||||     
3' cgguac agagggugucgaaagaacu gaagga    u
         a                   c      uucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05297: 20534-20609 [-]
intergenic
Database links

Mature sequence mes-miR396e

Accession MIMAT0029277
Sequence

10 - 

uuccacagcuuucuugaacuu

 - 30

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).