Stem-loop sequence mes-MIR396f

AccessionMI0024320 (change log)
DescriptionManihot esculenta miR396f stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention mes-MIR396f
(13 sentences)

Stem-loop
   u      c                         ucuucuu  ucu   u -    u  cuuc 
5'  gucaug uuuuccacagcuuucuugaacuucu       cu   ugu c uagc gg    u
    |||||| |||||||||||||||||||||||||       ||   ||| | |||| ||     
3'  cgguac agagggugucgaaagaacuugaaga       gg   acg g guug uc    u
   a      a                         uucuuac  --u   u u    u  uuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04151: 82007-82129 [+]
intergenic
Database links

Mature sequence mes-miR396f

Accession MIMAT0029278
Sequence

11 - 

uuccacagcuuucuugaacuu

 - 31

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).