Stem-loop sequence mes-MIR397

AccessionMI0024321 (change log)
DescriptionManihot esculenta miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

4 open access papers mention mes-MIR397
(8 sentences)

Stem-loop
   ucau        a      a    uu    a    uuucuaag 
5'     uugagugc gcguug ugaa  uccu caau        a
       |||||||| |||||| ||||  |||| ||||        u
3'     aauucacg cgcgac auuu  agga guug        u
   -acu        c      c    -u    a    uuuuaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05338: 120026-120112 [-]
intergenic
Database links

Mature sequence mes-miR397

Accession MIMAT0029279
Sequence

4 - 

uuugagugcagcguugauga

 - 23

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).