Stem-loop sequence mes-MIR477a

AccessionMI0024332 (change log)
DescriptionManihot esculenta miR477a stem-loop
Gene family MIPF0000216; MIR477
Literature search

4 open access papers mention mes-MIR477a
(8 sentences)

Stem-loop
       cu       c  c   gg        aguuuc    ug 
5' auua  cacucuc cu aag  cuucugug      uggu  a
   ||||  ||||||| || |||  ||||||||      ||||   
3' uaau  gugagag ga uuc  ggaggcau      acca  a
       ag       a  u   -a        ------    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06716: 23691-23769 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477a
mes-MIR477kscaffold06716: 23178-23352 [+]
mes-MIR477iscaffold06716: 23382-23488 [+]
mes-MIR477ascaffold06716: 23691-23769 [+]
Database links

Mature sequence mes-miR477a

Accession MIMAT0029290
Sequence

9 - 

cucucccucaagggcuucug

 - 28

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).