Stem-loop sequence mes-MIR477c

AccessionMI0024334 (change log)
DescriptionManihot esculenta miR477c stem-loop
Gene family MIPF0000216; MIR477
Literature search

3 open access papers mention mes-MIR477c
(6 sentences)

Stem-loop
   -------------ggaauucucgucaacgacaacaac       uaucc   a            c    g       --u   uuuc      ac 
5'                                      aauggca     auu uucacucucccu aagg cuucugu   ggu    uggucg  c
                                        |||||||     ||| |||||||||||| |||| |||||||   |||    ||||||   
3'                                      uuaccgu     uaa aggugagaggga uucc gaaggca   cca    accagu  g
   cuuuaagagccucaucucguuauuaagguacuuuagu       --uca   a            -    a       cau   -uga      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03175: 114710-114884 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477c
mes-MIR477bscaffold03175: 114424-114573 [+]
mes-MIR477cscaffold03175: 114710-114884 [+]
Database links

Mature sequence mes-miR477c

Accession MIMAT0029292
Sequence

45 - 

cucucccucaagggcuucug

 - 64

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).