Stem-loop sequence mes-MIR477d

AccessionMI0024335 (change log)
DescriptionManihot esculenta miR477d stem-loop
Gene family MIPF0000216; MIR477
Literature search

3 open access papers mention mes-MIR477d
(6 sentences)

Stem-loop
       g     g   c           -            -  -a           augcaugcauccaaacauuaaaagaa 
5' caag cauug uug ucacucucccu caagggcuucuc ca  ugugcccuagc                          g
   |||| ||||| ||| ||||||||||| |||||||||||| ||  |||||||||||                          a
3' guuc gugac aac agugaggggga guucucgaagag gu  guauggggucg                          a
       a     g   a           c            c  ag           aucagcuuuuacaaaaaagagaaagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02226: 32017-32178 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477d
mes-MIR477dscaffold02226: 32017-32178 [+]
mes-MIR477escaffold02226: 32349-32453 [+]
Database links

Mature sequence mes-miR477d

Accession MIMAT0029293
Sequence

19 - 

cucucccucaagggcuucuc

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).