Stem-loop sequence mes-MIR477e

AccessionMI0024336 (change log)
DescriptionManihot esculenta miR477e stem-loop
Gene family MIPF0000216; MIR477
Literature search

3 open access papers mention mes-MIR477e
(7 sentences)

Stem-loop
         uuc    cu          c    g          --uuuc     g 
5' auggca   auua  cacucucccu aagg cuucugcgug      ugguc a
   ||||||   ||||  |||||||||| |||| ||||||||||      |||||  
3' uaccgu   uaau  gugagaggga uucc gaagacgcau      accag a
         uca    ag          -    a          ucauaa     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02226: 32349-32453 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477e
mes-MIR477dscaffold02226: 32017-32178 [+]
mes-MIR477escaffold02226: 32349-32453 [+]
Database links

Mature sequence mes-miR477e

Accession MIMAT0029294
Sequence

18 - 

cucucccucaagggcuucug

 - 37

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).