Stem-loop sequence mes-MIR477f

AccessionMI0024337 (change log)
DescriptionManihot esculenta miR477f stem-loop
Gene family MIPF0000216; MIR477
Literature search

3 open access papers mention mes-MIR477f
(6 sentences)

Stem-loop
   gaa    -     -c        c              u    -c   cu    a 
5'    ggag aaguu  caaucucc ucaaaggcuuccaa auuc  agg  aauc u
      |||| |||||  |||||||| |||||||||||||| ||||  |||  ||||  
3'    ccuc uucgg  guuagggg aguuuccgaggguu uaag  ucu  uuag a
   cua    a     aa        a              u    aa   au    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04043: 624312-624420 [-]
intergenic
Database links

Mature sequence mes-miR477f

Accession MIMAT0029295
Sequence

16 - 

aucucccucaaaggcuucca

 - 35

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).