Stem-loop sequence mes-MIR477g

AccessionMI0024338 (change log)
DescriptionManihot esculenta miR477g stem-loop
Gene family MIPF0000216; MIR477
Literature search

3 open access papers mention mes-MIR477g
(6 sentences)

Stem-loop
     c    aca    -ua       --u    -      c        cu      cu         -   g 
5' ga acug   uugc   gaauggu   agag aagcuu caaucucc  caaagg  uccaauauu cca g
   || ||||   ||||   |||||||   |||| |||||| ||||||||  ||||||  ||||||||| ||| c
3' cu ugau   aacg   uuuacua   ucuc uucgga guuagggg  guuucc  agguuguaa ggu c
     u    acg    uaa       ccc    a      a        ag      ag         a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01701: 705026-705165 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477g
mes-MIR477gscaffold01701: 705026-705165 [+]
mes-MIR1446bscaffold01701: 706488-706623 [+]
Database links

Mature sequence mes-miR477g

Accession MIMAT0029296
Sequence

38 - 

aucucccucaaaggcuucca

 - 57

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).