Stem-loop sequence mes-MIR482

AccessionMI0024339 (change log)
DescriptionManihot esculenta miR482 stem-loop
Gene family MIPF0000403; MIR482
Literature search

5 open access papers mention mes-MIR482
(28 sentences)

Stem-loop
        aaa  ca    -uuu             ag      -a               -u ug    u 
5' ggaga   ag  agga    ucggaagguuaug  augggu  aguggggaagauaac  g  gggc u
   |||||   ||  ||||    |||||||||||||  ||||||  |||||||||||||||  |  ||||  
3' ccucu   uc  uccu    agccuuucgauac  uaccca  ucaucccuucuauug  u  uuug u
        --c  --    ugcu             cu      cc               uu gu    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02264: 510283-510413 [+]
intergenic
Database links

Mature sequence mes-miR482

Accession MIMAT0029297
Sequence

82 - 

ucuucccuacuccacccauucc

 - 103

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).